UNC1999

Catalogusnr.S7165 Batch:S716504

Afdrukken

Technische gegevens

Formule

C33H43N7O2

Molecuulgewicht 569.74 CAS-nr. 1431612-23-5
Oplosbaarheid (25°C)* In vitro DMSO 100 mg/mL (175.51 mM)
Ethanol 100 mg/mL (175.51 mM)
Water Insoluble
In Vivo (Voeg oplosmiddelen afzonderlijk en in volgorde toe aan het product.)
Homogeneous suspension
CMC-NA
≥5mg/ml Taking the 1 mL working solution as an example, add 5 mg of this product to 1 ml of CMC-Na solution, mix evenly to obtain a homogeneous suspension with a final concentration of 5 mg/ml.
Clear solution
5%DMSO 40%PEG300 5%Tween80 50%ddH2O

Gevalideerd door Selleck labs. Mocht u aanpassingen aan deze formulering nodig hebben, neem dan contact op met ons verkoopteam voor maatwerktesten.

5.000mg/ml (8.78mM) Taking the 1 mL working solution as an example, add 50 μL of 100 mg/ml clarified DMSO stock solution to 400 μL of PEG300, mix evenly to clarify it; add 50 μL of Tween80 to the above system, mix evenly to clarify; then continue to add 500 μL of ddH2O to adjust the volume to 1 mL. The mixed solution should be used immediately for optimal results. 
Clear solution
5% DMSO 95% Corn oil

Gevalideerd door Selleck labs. Mocht u aanpassingen aan deze formulering nodig hebben, neem dan contact op met ons verkoopteam voor maatwerktesten.

1.250mg/ml (2.19mM) Taking the 1 mL working solution as an example, add 50 μL of 25 mg/ml clear DMSO stock solution to 950 μL of corn oil and mix evenly. The mixed solution should be used immediately for optimal results. 
* <1 mg/ml betekent licht oplosbaar of onoplosbaar.
* Houd er rekening mee dat Selleck de oplosbaarheid van alle verbindingen intern test en de werkelijke oplosbaarheid enigszins kan afwijken van gepubliceerde waarden. Dit is normaal en is te wijten aan lichte batch-tot-batch variaties.
* Verzending op kamertemperatuur (Stabiliteitstests tonen aan dat dit product zonder koelmaatregelen kan worden verzonden.)

Voorbereiden van stamoplossingen

Biologische activiteit

Beschrijving UNC1999 is een potente, oraal biologisch beschikbare en selectieve remmer van EZH2 en EZH1 met een IC50 van respectievelijk 2 nM en 45 nM in celvrije testen, wat een >1000-voudige selectiviteit toont over een breed scala aan epigenetische en niet-epigenetische doelwitten. Deze verbinding is een potente autophagy-inductor. Het onderdrukt specifiek H3K27me3/2 en induceert een reeks anti-leukemische effecten, waaronder antiproliferatie, differentiatie en apoptosis.
Doelen
EZH2
(Cell-free assay)
EZH1
(Cell-free assay)
2 nM 45 nM
In vitro UNC1999 is in vitro zeer potent voor zowel EZH2 Y641N als EZH2 Y641F mutanten. Deze verbinding veroorzaakt concentratieafhankelijke reducties van H3K27me3 in MCF10A-cellen met een IC50 van 124 nM, terwijl het een lage cellulaire toxiciteit vertoont. Het vertoont een potente, concentratieafhankelijke remming van celproliferatie met een EC50 van 633 nM in een DLBCL-cellijn die de EZH2Y641N-mutant herbergt. Bovendien verrijkt gebiotinyleerde UNC1999 EZH2 uit HEK293T-celysaten, en kan dus worden gebruikt in chemoproteomische studies.
In Vivo Behandeling met UNC1999 (150 en 50 mg/kg, i.p.) resulteert in plasmaconcentraties van deze verbinding boven de cellulaire IC50 gedurende 24 uur in vivo. Bovendien is het ook oraal biologisch beschikbaar bij muizen, wat chronische dierstudies praktischer en handiger maakt.
Functies De eerste oraal biologisch beschikbare remmer tegen wild-type en mutante EZH2, evenals EZH1.

Protocol (uit referentie)

Kinase-assay:

[1]

  • Scintillatie Proximity Assay

    Methyltransferase-activiteitstesten worden uitgevoerd door de incorporatie van tritiumgelabelde methylgroepen van S-adenosylmethionine (3H-SAM) in gebiotinyleerde peptidesubstraten te monitoren met behulp van Scintillation Proximity Assay (SPA) voor het PRC2-EZH2 trimerische complex (EZH2:EED:SUZ12), PRC2-EZH1 pentamerische complex (EZH1:EED:SUZ12:RBBP4:AEBP2), SETD7, G9a, GLP, SETDB1, SETD8, SUV420H1, SUV420H2, SUV39H2, MLL1 tetramerische complex (MLL:WDR5:RbBP5:ASH2L), PRMT1, PRMT3, PRMT5-MEP50 complex en SMYD2. De reactiebuffer voor SMYD2 en SMYD3 is 50 mM Tris pH 9.0, 5 mM DTT, 0.01% TritonX-100; voor G9a, GLP en SUV39H2 is 25 mM kaliumfosfaat pH 8.0, 1 mM EDTA, 2 mM MgCl2 en 0.01% Triton X-100; en voor andere HMT's 20 mM Tris pH 8.0, 5 mM DTT, 0.01% TritonX-100. Om de enzymatische reacties te stoppen, wordt 10 μL van 7.5 M guanidinehydrochloride toegevoegd, gevolgd door 180 μL buffer, gemengd en overgebracht naar een 384-wells FlashPlate. Na het mengen worden de reactiemengsels geïncubeerd en worden de CPM-tellingen gemeten met behulp van een Topcount plaatlezer. De CPM-tellingen in afwezigheid van deze verbinding voor elke dataset worden gedefinieerd als 100% activiteit. In afwezigheid van het enzym worden de CPM-tellingen in elke dataset gedefinieerd als achtergrond (0%). IC50-waarden worden bepaald met behulp van compoundconcentraties variërend van 100 nM tot 100 μM. De IC50-waarden worden bepaald met behulp van SigmaPlot-software. EZH2-Y641F-testen worden uitgevoerd met 30 nM enzym in 20 mM Tris pH 8, 5 mM DTT, 0.01% Triton X-100, 5 μM SAM en 1 μM H3 (1-24) peptide (hetzelfde als voor het wild-type PRC2-EZH2-complex). Voor DNMT1 wordt de test uitgevoerd met hemigemethyleerd dsDNA als substraat. Het dsDNA-substraat wordt bereid door twee complementaire strengen (gebiotinyleerde voorwaartse streng: BGAGCCCGTAAGCCCGTTCAGGTCG en omgekeerde streng: CGACCTGAACGGGCTTACGGGCTC), gesynthetiseerd door Eurofins MWG Operon, te hybridiseren. De reactiebuffer is 20 mM Tris-HCl, pH 8.0, 5 mM DTT, 0.01% Triton X-100. Methyltransferase-activiteitstesten voor DOT1L worden uitgevoerd met filterplaten. Reactiemengsels in 20 mM Tris-HCl, pH 8.0, 5 mM DTT, 2 mM MgCl2 en 0.01% Triton X-100 worden 1 uur bij kamertemperatuur geïncubeerd, 100 μL 10% TCA wordt toegevoegd, gemengd en overgebracht naar een filterplaat. Platen worden gecentrifugeerd bij 2000 tpm gedurende 2 minuten, gevolgd door 2 extra wasbeurten met 10% TCA en één ethanolwas (180 μL), gevolgd door centrifugatie. Platen worden gedroogd en 100 μL MicroO wordt toegevoegd en gecentrifugeerd. 70 μL MicroO wordt toegevoegd en CPM wordt gemeten met behulp van een Topcount plaatlezer.

Celassay:

[1]

  • Cellijnen

    DLBCL cell line harboring the EZH2Y641N mutant

  • Concentraties

    ~5 μM

  • Incubatietijd

    8 days

  • Methode

    DB cells, a diffuse-large B-cell lymphoma cell line harboring the EZH2 Y641N mutation, are obtained from ATCC and cultured in RPMI 1640 supplemented with 10% fetal bovine serum, antibiotics, and various concentrations of compounds (DMSO control, UNC1999, or UNC2400). The medium containing the test compound or control is refreshed every 3 days. The numbers of viable cells from at least three independent experiments are measured using TC20 automated cell counter system. Total histones are prepared from cell nuclei using an acidic extraction protocol. About 1 μg of total histones is separated using 15% SDS-PAGE, transferred to PVDF membranes, and probed with histone antibodies. Antibodies used in this study are those against EZH2, general H3, and H3K27me3.

Dierstudie:

[1]

  • Dierlijke modellen

    Male Swiss albino mice

  • Doseringen

    ~150 mg/kg (i.p.), ~50 mg/kg (oral)

  • Toediening

    Intraperitoneal administration or oral administration

Referenties

  • https://pubmed.ncbi.nlm.nih.gov/23614352/
  • http://www.thesgc.org/chemical-probes/UNC1999

Klantproductvalidatie

Ex vivo growth of the SCLC PDX LX92 is significantly inhibited by the EZH2 inhibitors EPZ-5687, GSK343 and UNC1999 as measured by resazurin conversion (two-way analysis of variance, adjusted for multiple comparisons by the method of Dunnet).

Gegevens van [ , , Oncogene, 2015, 10.1038/onc.2015.38 ]

A. Treatment with UNC1999 (4-6 μM) reduces viable cell numbers in BT73 as assessed by trypan blue exclusion (n=3; ** P<0.01). B. Treatment with varying concentrations of UNC1999 impairs self renewal in BT73 and BT147 as assessed by sphere assay (n=3).

Gegevens van [ , , Oncotarget, 2016, 7(37):59360-59376 ]

Sellecks UNC1999 Is geciteerd door 34 Publicaties

Inhibition of PRC2 enables self-renewal of blastoid-competent naive pluripotent stem cells from chimpanzee [ Cell Stem Cell, 2025, S1934-5909(25)00041-4] PubMed: 40015279
Chromatin modification abnormalities by CHD7 and KMT2C loss promote medulloblastoma progression [ Cell Rep, 2025, 44(5):115673] PubMed: 40393452
Epigenetic modifiers to treat retinal degenerative diseases [ bioRxiv, 2025, 2025.05.22.655558] PubMed: 40501782
LSD1 inhibition improves efficacy of adoptive T cell therapy by enhancing CD8+ T cell responsiveness [ Nat Commun, 2024, 15(1):7366] PubMed: 39191730
Ezh2 Delays Activation of Differentiation Genes During Normal Cerebellar Granule Neuron Development and in Medulloblastoma [ bioRxiv, 2024, 2024.11.21.624171] PubMed: 39605517
Hedgehog pathway orchestrates the interplay of histone modifications and tailors combination epigenetic therapies in breast cancer [ Acta Pharm Sin B, 2023, 13(6):2601-2612] PubMed: 37425067
EZH2-H3K27me3-mediated silencing of mir-139-5p inhibits cellular senescence in hepatocellular carcinoma by activating TOP2A [ J Exp Clin Cancer Res, 2023, 42(1):320] PubMed: 38008711
BRD4770 functions as a novel ferroptosis inhibitor to protect against aortic dissection [ Pharmacol Res, 2022, 177:106122] PubMed: 35149187
Dual targeting of EZH1 and EZH2 for the treatment of malignant rhabdoid tumors [ Mol Ther Oncolytics, 2022, 27:14-25] PubMed: 36212776
Enhanced Calcium Signal Induces NK Cell Degranulation but Inhibits Its Cytotoxic Activity [ J Immunol, 2022, 208(2):347-357] PubMed: 34911773

RETOURBELEID
Selleck Chemicals onvoorwaardelijke retourbeleid zorgt voor een soepele online winkelervaring voor onze klanten. Als u op enigerlei wijze ontevreden bent met uw aankoop, kunt u elk artikel(en) binnen 7 dagen na ontvangst retourneren. In geval van problemen met de productkwaliteit, zowel protocolgerelateerde als productgerelateerde problemen, kunt u elk artikel(en) binnen 365 dagen na de oorspronkelijke aankoopdatum retourneren. Volg de onderstaande instructies bij het retourneren van producten.

VERZENDING EN OPSLAG
Selleck producten worden bij kamertemperatuur vervoerd. Als u het product op kamertemperatuur ontvangt, wees dan gerust, de Selleck kwaliteitsinspectieafdeling heeft experimenten uitgevoerd om te controleren of de normale temperatuurplaatsing van één maand de biologische activiteit van poederproducten niet beïnvloedt. Na ontvangst dient u het product op te slaan volgens de vereisten beschreven in het gegevensblad. De meeste Selleck producten zijn stabiel onder de aanbevolen omstandigheden.

NIET VOOR HUMANE, VETERINAIRE DIAGNOSTISCHE OF THERAPEUTISCHE DOELEINDEN.